Lactarius fluens

Boud. (1899)

Rjaveča mlečnica

Rod Mlečnice, sirovke | Lactarius | Neužitna

Neužitna

Podrobnosti

Opombe

Nukleotidno zaporedje ITS:

CATTATCGTACAAAAATGTGTGAGGCATGCGAGGGCTGTCGCTGACTTTTGAAGTCGTGCACGCCAGAGCGTGTCCTCTCACATATAATCCATCTCACCCTCTTGTGCACCACCGCGTGGGCACCCTTCGGGATCGATTCGATCCAGGAGGGGGCTTGCGTTTTCACACAAACCCCTTTTTAAAAAAGTGTAGAATGACCTCATCTTTGCAATAAAACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTTCTCGGTTTCTTCTGGACACCGAAGGAGGCTTGGACTTTGGAGGCCTTTGCTGGCGTCTCTCTCTTTTGAAAGGCCAGCTCCTCTCAAATGAATTAGCGGGGTCCTCTTTGCCGATCCTCGACATGTGATAAGATGCTTCCATGTCTTGGTTTATGGCTCTGTTGCCTTTGGGACCCGCTTCTAATCGTCTCGAGACAATGTTTGAGCGCGTCTCCCTTCTCGGGAAACGCTCTCGAACCCACGAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATAT

Sekvenciranje: T. Grebenc (GIS)*
* sekvenciranje je bilo izvedeno na Gozdarskem Inštitutu Slovenije (GIS) v okviru Raziskovalnega Programa P4-0107 Gozdna biologija, ekologija in tehnologija (financer: ARRS) in raziskovalnega projekta J4-1766 “Methodology approaches in genome-based diversity and ecological plasticity study of truffles from their natural distribution areas” (financer: ARRS).