Auricularia mesenterica

(Dicks.) Pers. (1822)

Brestova uhljevka

Rod Uhljevke | Auricularia | Neužitna

Neužitna

Podrobnosti

Značilno

Trosnjak resupinat do semipileat, ohlapno zraščen s substratom, prekriva površino od nekaj centimetrov do nekaj decimetrov.

Klobuk

Bolj ali manj izraziti, 10-30 mm odmaknjeni od substrata, prekrivajo se kot strešniki, na površini koncentrični pasovi, klobučevinastega izgleda, valoviti, pasovi izmenoma svetlo sive/olivno rjave barve, rob valovit, krpast.

Trosovnica

Na spodnji strani, ki je žilnato nagubana, škrlatno rjava, včasih z belkastim poprhom od trosnega prahu, 2-5 mm debela.

Meso

Elastično, žilavo, zdrizasto, v suhem stanju roževinasto, trdo, krhko, neznatnega vonja, milega okusa.

Trosi

Valjasti, alantoidni, gladki, prosojni, s kapljicami, 15-17, 5 x 6-7 μm.

Rastišče

Parazit ali saprofit na bukvah in javorjih, kot tudi na lesu drugih listavcev. Skozi vso leto. Na Bovškem redka. Rada se pojavlja na toplih, južnih legah.

Uporabnost

Neužitna.

Opombe

CATTAAAGATTCGAGCTATGCAGCTCTGCCTTTTCCTCAGCTGTGCGCTTAGGCTGCACGCTGTCGAACAACTCACACCTGTGCACCTTTTCGGTTGCGGCCTCTGGTCGCTTCCGCTTTACATGCAACCACAATCGGTCTAGAATGTGTATAAAACTATAAAGTAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTACTCCATGGAGCATGCCTGTTTGAGTGTCACGTAAACCCTCACCCTTGCGATGTAACAGTCGTTCGTGGTGGACTTGGACCGTGCCGTAGTTGGCTCGTCCTGAAATGCATTAGCTGGTGCTTTTAGAGTGCTGGGCGACGGTGTGATAATTATCTGCGCCAATGCCCTGGGCCTCTTCAGCGGTGCCGCTTACAGTCGTCCCC

Nukleotidno zaporedje  vzorca z več kot 99% podobnostjo sovpada za zaporedji vrste Auricularia mesenterica. Ker ni drugih primerljivo podobnih zaporedij z drugimi imeni lahko zaključim, da gre za to vrsto.

Sekvenciranje: T. Grebenc GIS
* sekvenciranje je bilo izvedeno na Gozdarskem Inštitutu Slovenije (GIS) v okviru Raziskovalnega Programa P4-0107 Gozdna biologija, ekologija in tehnologija (financer: ARRS) in raziskovalnega projekta J4-1766 “Methodology approaches in genome-based diversity and ecological plasticity study of truffles from their natural distribution areas” (financer: ARRS).

 

Spada med

Lesne gobe